|
Left Crispr |
Right Crispr |
| Crispr ID |
987016189 |
987016194 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:13822364-13822386
|
5:13822403-13822425
|
| Sequence |
CCTCAGCATCCAGAGTAGATGGG |
ACCATGCCCAACTAATTTTTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 2, 1: 166, 2: 11931, 3: 223996, 4: 280796} |
{0: 5, 1: 117, 2: 340, 3: 671, 4: 899} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|