ID: 987050577_987050590

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 987050577 987050590
Species Human (GRCh38) Human (GRCh38)
Location 5:14144138-14144160 5:14144175-14144197
Sequence CCCCTCGTTTTAGGGCAGAATCC CCCGGCAGCCGCGGCTTCGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 59} {0: 1, 1: 1, 2: 0, 3: 18, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!