ID: 987066736_987066744

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 987066736 987066744
Species Human (GRCh38) Human (GRCh38)
Location 5:14297235-14297257 5:14297274-14297296
Sequence CCTCCATTTTCCACCAGAAGGCC TGAACCCCCAGCCCACGAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 172} {0: 1, 1: 0, 2: 1, 3: 7, 4: 152}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!