ID: 987081798_987081805

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 987081798 987081805
Species Human (GRCh38) Human (GRCh38)
Location 5:14431850-14431872 5:14431898-14431920
Sequence CCACCCTCTTGCTGATTCTCCAT TTTCTGTAAGAACACCAGTCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 35, 4: 404} {0: 1, 1: 0, 2: 1, 3: 20, 4: 155}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!