ID: 987309547_987309556

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 987309547 987309556
Species Human (GRCh38) Human (GRCh38)
Location 5:16669067-16669089 5:16669101-16669123
Sequence CCCCATATGAAGGGGCTAACAAC CCAAACCTGGACAAGCAGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 61} {0: 1, 1: 0, 2: 0, 3: 16, 4: 182}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!