ID: 987578340_987578344

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 987578340 987578344
Species Human (GRCh38) Human (GRCh38)
Location 5:19758303-19758325 5:19758337-19758359
Sequence CCAGTAACAGGCCAAGAGCTGCC CAGTAATTATATGCAGAAGATGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 19, 3: 240, 4: 441}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!