ID: 987606625_987606632

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 987606625 987606632
Species Human (GRCh38) Human (GRCh38)
Location 5:20144166-20144188 5:20144195-20144217
Sequence CCTCTTTGAGGTTCCAGAGGGCA CACGGACAGCCTGGGAAACTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 218} {0: 1, 1: 0, 2: 3, 3: 60, 4: 1425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!