ID: 987739111_987739116

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 987739111 987739116
Species Human (GRCh38) Human (GRCh38)
Location 5:21882745-21882767 5:21882798-21882820
Sequence CCGTTACAATGGAGCCAAAGGGA AGTCCCAACGTAACAAAAGATGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 4, 3: 13, 4: 159} {0: 1, 1: 6, 2: 3, 3: 17, 4: 98}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!