ID: 987774691_987774697

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 987774691 987774697
Species Human (GRCh38) Human (GRCh38)
Location 5:22349076-22349098 5:22349101-22349123
Sequence CCTTGTCCCTTCACCATATGAGG ACCATGTGCAGGCACAGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 23, 4: 195} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!