ID: 987783668_987783672

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 987783668 987783672
Species Human (GRCh38) Human (GRCh38)
Location 5:22470706-22470728 5:22470741-22470763
Sequence CCTTGCCCAGTCTTCTTTTCTAT ATGATAGTCATCAGATTAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 35, 3: 255, 4: 2019} {0: 1, 1: 0, 2: 1, 3: 10, 4: 160}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!