|
Left Crispr |
Right Crispr |
| Crispr ID |
988489087 |
988489098 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
5:31692017-31692039
|
5:31692045-31692067
|
| Sequence |
CCTCAGCCCTTGGGTGGTCGATG |
GGGCGCAGTGGAGCACGGGGTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 672, 1: 634, 2: 441, 3: 258, 4: 206} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|