ID: 988496670_988496674

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 988496670 988496674
Species Human (GRCh38) Human (GRCh38)
Location 5:31751347-31751369 5:31751361-31751383
Sequence CCTTGCAGGGGACCTTGCAATTA TTGCAATTAAGAGGTCTAGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92} {0: 1, 1: 0, 2: 0, 3: 8, 4: 85}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!