ID: 988496670_988496678

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 988496670 988496678
Species Human (GRCh38) Human (GRCh38)
Location 5:31751347-31751369 5:31751373-31751395
Sequence CCTTGCAGGGGACCTTGCAATTA GGTCTAGGTGGGAAATGATGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 92} {0: 1, 1: 0, 2: 3, 3: 25, 4: 281}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!