ID: 988523322_988523334

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 988523322 988523334
Species Human (GRCh38) Human (GRCh38)
Location 5:31965253-31965275 5:31965306-31965328
Sequence CCCAAGTGGGGTGGAAACCAGCC TCTGATTTGCATAGGGCACAGGG
Strand - +
Off-target summary No data {0: 3, 1: 101, 2: 160, 3: 89, 4: 214}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!