ID: 988556710_988556714

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 988556710 988556714
Species Human (GRCh38) Human (GRCh38)
Location 5:32242781-32242803 5:32242810-32242832
Sequence CCCTGTCTGCCATTATATATTCA GAGACGTGTAGCAGGATGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 246} {0: 1, 1: 0, 2: 0, 3: 16, 4: 118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!