ID: 988577843_988577853

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 988577843 988577853
Species Human (GRCh38) Human (GRCh38)
Location 5:32444257-32444279 5:32444303-32444325
Sequence CCGCCCCGCTGTGGGTGAATCCA GGCATCTTCCCCCAGCCGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 76} {0: 1, 1: 1, 2: 0, 3: 20, 4: 139}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!