ID: 988614692_988614698

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 988614692 988614698
Species Human (GRCh38) Human (GRCh38)
Location 5:32764163-32764185 5:32764202-32764224
Sequence CCTTCGTGCATGTGCAGTTTAGG CAGAAGTTTATGAAAGACTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 49} {0: 1, 1: 0, 2: 2, 3: 33, 4: 261}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!