ID: 988739805_988739807

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 988739805 988739807
Species Human (GRCh38) Human (GRCh38)
Location 5:34059174-34059196 5:34059198-34059220
Sequence CCAAGATCAAGGTGTACAGGGTG GTGTCTCCTTGGTTTGCAAATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 140} {0: 1, 1: 2, 2: 7, 3: 95, 4: 741}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!