ID: 988740537_988740545

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 988740537 988740545
Species Human (GRCh38) Human (GRCh38)
Location 5:34064630-34064652 5:34064672-34064694
Sequence CCGGATCTGGAGGGGTGGAAGTC CGGCAAACAGCAGTGGTGGATGG
Strand - +
Off-target summary No data {0: 62, 1: 126, 2: 64, 3: 58, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!