ID: 988840759_988840765

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 988840759 988840765
Species Human (GRCh38) Human (GRCh38)
Location 5:35081454-35081476 5:35081486-35081508
Sequence CCAAATATGACATCAAAAAGGTG GCATCGGAGGGCCCCTTCATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 179} {0: 1, 1: 0, 2: 2, 3: 14, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!