ID: 988843254_988843255

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 988843254 988843255
Species Human (GRCh38) Human (GRCh38)
Location 5:35103949-35103971 5:35103965-35103987
Sequence CCTTTTTTTTTTAAAGCTGTGTA CTGTGTAAGTGCATGTGCCCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 189}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!