ID: 989017945_989017952

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 989017945 989017952
Species Human (GRCh38) Human (GRCh38)
Location 5:36962202-36962224 5:36962253-36962275
Sequence CCACAAAGCCCTGCAGGATACAT ACACATCCACAGATGCAACAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 210} {0: 1, 1: 0, 2: 0, 3: 14, 4: 207}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!