|
Left Crispr |
Right Crispr |
Crispr ID |
989059556 |
989059557 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
5:37396945-37396967
|
5:37396978-37397000
|
Sequence |
CCAGCTTGGGCAACATGGCGAAA |
ACAAAAATGCAAAAATTAGACGG |
Strand |
- |
+ |
Off-target summary |
{0: 128, 1: 3803, 2: 38389, 3: 169313, 4: 257938} |
{0: 2, 1: 60, 2: 2102, 3: 17456, 4: 121645} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|