ID: 989059556_989059557

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 989059556 989059557
Species Human (GRCh38) Human (GRCh38)
Location 5:37396945-37396967 5:37396978-37397000
Sequence CCAGCTTGGGCAACATGGCGAAA ACAAAAATGCAAAAATTAGACGG
Strand - +
Off-target summary {0: 128, 1: 3803, 2: 38389, 3: 169313, 4: 257938} {0: 2, 1: 60, 2: 2102, 3: 17456, 4: 121645}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!