ID: 989082273_989082286

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 989082273 989082286
Species Human (GRCh38) Human (GRCh38)
Location 5:37635772-37635794 5:37635814-37635836
Sequence CCCACCCAAATCTCATCTTGAAT ATGTGTCATGGGAGGGTGGGAGG
Strand - +
Off-target summary {0: 7461, 1: 10942, 2: 10318, 3: 7687, 4: 6503} {0: 1, 1: 0, 2: 1, 3: 36, 4: 500}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!