ID: 989139404_989139412

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 989139404 989139412
Species Human (GRCh38) Human (GRCh38)
Location 5:38188527-38188549 5:38188575-38188597
Sequence CCAGCCTGTGTTCTACTCTGACC CTGCATATTTTCATAACTTTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 46, 4: 392}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!