ID: 989153028_989153033

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 989153028 989153033
Species Human (GRCh38) Human (GRCh38)
Location 5:38318995-38319017 5:38319026-38319048
Sequence CCATAGTCCTCACTAGGCGTTCC CATGCTCCAGGCTCATGAGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 52} {0: 1, 1: 1, 2: 0, 3: 10, 4: 161}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!