ID: 989180065_989180076

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 989180065 989180076
Species Human (GRCh38) Human (GRCh38)
Location 5:38567754-38567776 5:38567802-38567824
Sequence CCTGACCACAGGTGATCTGCCCA TATAGGCATGAGCCACCACCTGG
Strand - +
Off-target summary {0: 45, 1: 8400, 2: 27404, 3: 63137, 4: 90340} {0: 5, 1: 54, 2: 172, 3: 469, 4: 839}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!