ID: 989256302_989256306

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 989256302 989256306
Species Human (GRCh38) Human (GRCh38)
Location 5:39369294-39369316 5:39369329-39369351
Sequence CCCACACCATGGTCTTGCTGGAG ATGATTTCAGTATGTGGTAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 15, 4: 191}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!