ID: 989428811_989428816

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 989428811 989428816
Species Human (GRCh38) Human (GRCh38)
Location 5:41327928-41327950 5:41327956-41327978
Sequence CCCAAAGCGCTGGGATTACAGGC CCACTGTGCTTGGCAGATGCTGG
Strand - +
Off-target summary {0: 2178, 1: 223513, 2: 277731, 3: 230911, 4: 270282} {0: 1, 1: 0, 2: 3, 3: 39, 4: 371}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!