ID: 989430563_989430566

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 989430563 989430566
Species Human (GRCh38) Human (GRCh38)
Location 5:41350217-41350239 5:41350263-41350285
Sequence CCGTCCTCTGTTTTCTCATTGAA AAGCTAAATCTACAGCATAGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 54, 4: 644} {0: 1, 1: 0, 2: 0, 3: 7, 4: 101}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!