ID: 989444418_989444421

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 989444418 989444421
Species Human (GRCh38) Human (GRCh38)
Location 5:41510698-41510720 5:41510711-41510733
Sequence CCGTGCTCCCTTAGTGCCTCCGC GTGCCTCCGCCAGACTCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 136} {0: 1, 1: 0, 2: 0, 3: 4, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!