ID: 989545341_989545348

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 989545341 989545348
Species Human (GRCh38) Human (GRCh38)
Location 5:42665967-42665989 5:42665998-42666020
Sequence CCATGATTCAATTACCTTCCACC CTCATGACACATGCGGATTATGG
Strand - +
Off-target summary {0: 109, 1: 2008, 2: 5532, 3: 9528, 4: 10863} {0: 2, 1: 47, 2: 581, 3: 1510, 4: 2895}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!