ID: 989803810_989803816

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 989803810 989803816
Species Human (GRCh38) Human (GRCh38)
Location 5:45579962-45579984 5:45580003-45580025
Sequence CCATTTAGATGCAATATCCTTCC ATTAATTGAAAGATATATACTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 37, 4: 488}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!