ID: 990020113_990020117

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 990020113 990020117
Species Human (GRCh38) Human (GRCh38)
Location 5:51116357-51116379 5:51116403-51116425
Sequence CCTGACTGTGTTTTATTTTTTAT TGTCCACTCAGGAGACCTTCAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 18, 4: 153}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!