ID: 990159599_990159604

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 990159599 990159604
Species Human (GRCh38) Human (GRCh38)
Location 5:52923099-52923121 5:52923112-52923134
Sequence CCTGGGGAATTTTAAGGAGTTAG AAGGAGTTAGATGTGGGGCAGGG
Strand - +
Off-target summary {0: 2, 1: 1, 2: 0, 3: 13, 4: 125} {0: 3, 1: 0, 2: 3, 3: 39, 4: 307}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!