ID: 990282857_990282869

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 990282857 990282869
Species Human (GRCh38) Human (GRCh38)
Location 5:54270453-54270475 5:54270499-54270521
Sequence CCTACCATAACTTAGAATGCCCA CCTGGTTTCGACACACTAATTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 6, 4: 52}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!