ID: 990382518_990382529

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 990382518 990382529
Species Human (GRCh38) Human (GRCh38)
Location 5:55231485-55231507 5:55231530-55231552
Sequence CCTCCAGCGCCGCCTCCGGGTGG GCCGCGAGACCCGCAGCATGCGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 267} {0: 1, 1: 0, 2: 0, 3: 7, 4: 62}
Status Complete

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
22 5:55231485-55231507 CCTCCAGCGCCGCCTCCGGGTGG - 5:55231530-55231552 GCCGCGAGACCCGCAGCATGCGG +