ID: 990455779_990455781

View in Genome Browser

Spacer: 0

Left Crispr Right Crispr
Crispr ID 990455779 990455781
Species Human (GRCh38) Human (GRCh38)
Location 5:55986162-55986184 5:55986185-55986207
Sequence CCTTACTGATTTTCTGACTACTA CTTCTATCATTGTTCAAAAAGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 33, 3: 213, 4: 605} {0: 1, 1: 0, 2: 2, 3: 24, 4: 276}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!