ID: 990728537_990728542

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 990728537 990728542
Species Human (GRCh38) Human (GRCh38)
Location 5:58783773-58783795 5:58783805-58783827
Sequence CCTTCCCCTTTATCCACAAACAA TAAGATTTCCTAAGCAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 271} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!