ID: 990779085_990779088

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 990779085 990779088
Species Human (GRCh38) Human (GRCh38)
Location 5:59337797-59337819 5:59337811-59337833
Sequence CCTTTGAAGTGAATTGGGGTATT TGGGGTATTCTGAATGGGCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 115} {0: 1, 1: 0, 2: 1, 3: 14, 4: 140}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!