ID: 990798719_990798722

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 990798719 990798722
Species Human (GRCh38) Human (GRCh38)
Location 5:59574525-59574547 5:59574558-59574580
Sequence CCAGTCAGCATCAGAGTTGAATT TCAATACAGCTTTAAAGCATGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 13, 4: 172}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!