ID: 990801713_990801715

View in Genome Browser

Spacer: 25

Left Crispr Right Crispr
Crispr ID 990801713 990801715
Species Human (GRCh38) Human (GRCh38)
Location 5:59611481-59611503 5:59611529-59611551
Sequence CCTTGTAACACTCATCACAACCT TGAATGCCCGTCTCCACACTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 191} {0: 1, 1: 0, 2: 0, 3: 8, 4: 86}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!