ID: 990849135_990849144

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 990849135 990849144
Species Human (GRCh38) Human (GRCh38)
Location 5:60181960-60181982 5:60181995-60182017
Sequence CCCTCCCCTGATTAGCTAAAAGC AGGCATTAGCAGAGGGAAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 89} {0: 1, 1: 0, 2: 3, 3: 40, 4: 417}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!