ID: 990955272_990955287

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 990955272 990955287
Species Human (GRCh38) Human (GRCh38)
Location 5:61333220-61333242 5:61333254-61333276
Sequence CCCTACCCGCCCTCCTCCGGGGA AGGGCTGTTCGCCGGTTTCGGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 0, 4: 11}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!