ID: 990955815_990955823

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 990955815 990955823
Species Human (GRCh38) Human (GRCh38)
Location 5:61337106-61337128 5:61337159-61337181
Sequence CCTCATCTCTACTAAAAATACAA AATCCCGCCGCTCGGGAGGCTGG
Strand - +
Off-target summary {0: 82079, 1: 170980, 2: 171502, 3: 107694, 4: 70628} {0: 1, 1: 0, 2: 2, 3: 15, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!