ID: 990968416_990968425

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 990968416 990968425
Species Human (GRCh38) Human (GRCh38)
Location 5:61475721-61475743 5:61475773-61475795
Sequence CCTTAAGTGATGAAATGGGAAAT TTAATGACTTAATAGGTGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 18, 4: 277} {0: 1, 1: 0, 2: 0, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!