ID: 990985497_990985502

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 990985497 990985502
Species Human (GRCh38) Human (GRCh38)
Location 5:61637788-61637810 5:61637808-61637830
Sequence CCTCAGGGCAAAGAAGCCTGCAG CAGAATAATTGGGAGGAGTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 293} {0: 1, 1: 0, 2: 2, 3: 15, 4: 215}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!