ID: 991019482_991019487

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 991019482 991019487
Species Human (GRCh38) Human (GRCh38)
Location 5:61964928-61964950 5:61964967-61964989
Sequence CCCTGGGAAAGGTGCAGAGATGA CTTGAAAGAAGCAGAAGTGGTGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 7, 3: 46, 4: 384}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!