ID: 991344717_991344723

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 991344717 991344723
Species Human (GRCh38) Human (GRCh38)
Location 5:65651604-65651626 5:65651630-65651652
Sequence CCATCAAAAATAGTTTCAAAACA GTTTAGCACATTTATGTGGGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 88, 4: 841} {0: 1, 1: 0, 2: 0, 3: 9, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!