ID: 991437474_991437476

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 991437474 991437476
Species Human (GRCh38) Human (GRCh38)
Location 5:66611418-66611440 5:66611437-66611459
Sequence CCTCTTCTCTGCTTCCTCTTTCT TTCTGTCCTCCTCTCATGAGAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 25, 3: 347, 4: 2436} {0: 1, 1: 0, 2: 2, 3: 12, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!